Category: Python

Design at least three lessons that use graphics to explain coding concepts to students. The three lessons should be graphical in nature using events and animation. Themes of the lessons are your choice but some ideas: variables, branching, loops, functions, an algorithm, sorting, etc. also don’t use advance topics. Use turtle graphics and animations. I […]

Write a function called palindrome that takes a string argument and returns True if it is a palindrome and False otherwise. Remember that you can use the built-in function len( ) to check the length of a string. answer: Here’s a Python function called `is_palindrome` that checks if a string is a palindrome: “`python def […]

>Write a function called gcd that takes parameters a and b and returns their greatest common divisordivisor Answer: You can implement the greatest common divisor (GCD) function using the Euclidean algorithm. Here’s how you can do it in Python: “`python def gcd(a, b): while b: a, b = b, a % b return a # […]

You can use Python’s NumPy library to convert a list and tuple into arrays. Here’s a simple program to demonstrate this: “`python import numpy as np def convert_to_array(input_data): if isinstance(input_data, list): return np.array(input_data) elif isinstance(input_data, tuple): return np.array(input_data) else: raise ValueError(“Input data must be either a list or a tuple”) # Example usage: input_list = […]

upper = 1000 print(“Prime numbers between”, lower, “and”, upper, “are:”) for num in range(lower, upper + 1): # all prime numbers are greater than 1 if num > 1: for i in range(2, num): if (num % i) == 0: break else: print(num) Output: Theoutput of this program will be the prime numbers between 900 […]

Provide code and the expected output 1. Street Gaussians for Modeling Dynamic Urban Scenes 2.Title: Word-As-Image for Semantic Topography 3. 3D Gaussian Splatting for Real-time Radiance Field Rendering 4. Segmenting 3D Scenes with SAM check out this links done https://wordasimage.github.io/Word-As-Image-Page/ done https://github.com/graphdeco-inria/gaussian-splatt… done https://github.com/Pointcept/SegmentAnything3D

The initial project consisted of developing a machine learning model in Python for a specific application or problem domain. The project requires to demonstrate the understanding of data preprocessing, model selection, evaluation metrics, and effective communication of results. This step of creating the machine learning model in Python is already finished and I will provide […]

Example: Suppose that your program receives the … Patient Sample 11223344 GGTCGGTAGACAGGTCGGTAGACAGGTCGGTAGACA 22233344 TTTCAGAATTAGACTGTTTAGAGAAACTAGACCACA 33344455 CCTAGTATGCACTATTGAAATGCTCGTTGATAGACA 55667788 TGCTCGTTAGTGAACACTTAGACTGTTTAGGACCAC You know from a that these DNA sequences convert to… Glycine,Arginine,.,Threonine,Glycine,Arginine,.,Threonine,Glycine,Arginine,.,Threonine Phenylalanine,Glutamine,Asparagine,.,Threonine,Valine,.,Arginine,Asparagine,.,Threonine,Threonine Proline,Serine,Methionine,Histidine,Tyrosine,.,Asparagine,Alanine,Arginine,.,.,Threonine Cysteine,Serine,Leucine,Valine,Asparagine,Threonine,.,Threonine,Valine,.,Aspartic acid,Histidine These are amino acid sequences, and your program’s job is to let the user search for patients whose amino acid sequences contain […]

Exercise 11.1 Pick a stock. Get the historical data from Yahoo Finance and calculate the latest 20-day moving average of prices. Make connection to IB IPA system and buy the stock if its price is above moving average and short-sell it if the price is lower than the moving average. You dont need to design […]

Learning Goal: I’m working on a python question and need the explanation and answer to help me learn. In this unit, we explored the basic concepts of fundamental concepts of Iterations and Strings in Python. Before completing this assignment, review the reading material listed below: Chapters 7 – Iterations (p. 63- 69) Chapters 8- Strings […]