Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage.
3′ TACTAGCCACATCTACCGATC 5′ Template strand used for transcription
5′ ATGATCGGTGTAGATGGCTAG 3′ Coding (“inactive” strand)
An electron micrograph shows a structure with a rigid outer wall, a membrane, ribosomes, a nonmembrane bound nuclear area, and no endoplasmic reticulum or mitochondria. Explain why the structure is or is not each of the following: a human T cell, a virus, a bacterial cell, a yeast cell.
Describe the difference between an emerging and a re-emerging disease and give a recent example of a viral or a bacterial infection of each and explain the reason for that classification.
Name the four types of acquired immunity and describe the mechanisms by which a person acquires the immunity (“how it is conferred”). In a table describe the following characteristics for each them: type of immunizing agent (antibodies or antigen), relative time for immunity to appear, relative time the immunity lasts, and the source of antibodies (for example, self or non-self) that act against a pathogen or other antigen
