You were able to isolate and sequence the following section of bacterial DNA and you have evidence t Show more You were able to isolate and sequence the following section of bacterial DNA and you have evidence that you generated the sequence for the sense strand of the gene. The protein produced from this DNA molecule is very short only 4 amino acids long. 5AAATTGACACCTAATTCGGCGCTATCTTATAATCGTGCCTGTATGTTTCGTCGTTAA3 A) [2 points] Find highlight and label the functional DNA bases in the above gene that determine transcription and translation. B) [2 points] What kind of transcription factor binds to the DNA bases you found on the 5 end of the above gene and what role does it play? C) [2 points] Write out the sequence for the antisense strand of the above sequence. D) [2 points] Write out the coding portion of the RNA transcript that will be produced by RNA polymerase for the above gene segment. E) [2 points] What will be the 4 amino acid sequence of this polypeptide? Show less
